View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15394_low_41 (Length: 201)
Name: NF15394_low_41
Description: NF15394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15394_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 46207746 - 46207930
Alignment:
| Q |
1 |
aatgaatatatttgtaatttgaaatagagtttataatatttagcaannnnnnnnnaaaagcgacttattatttagagaaaaaagatagcaaatataaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46207746 |
aatgaatatatttgtaatttgaaatagagtttataatatttagcaaattttttttaaaagcgacttattatttagagaaaaaagatagcaaatataaatg |
46207845 |
T |
|
| Q |
101 |
ttaaagcttgcttgttgctaaacacatggtatggttattggaaggctacgtgctttctctaactcactttttattgatacctttg |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46207846 |
ttaaagcttgcttgttgctaaacacatggtatggttattggaaggctacgtgctttctctaactcactttttattgatacctttg |
46207930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 93 - 185
Target Start/End: Complemental strand, 29835505 - 29835415
Alignment:
| Q |
93 |
tataaatgttaaagcttgcttgttgctaaacacatggtatggttattggaaggctacgtgctttctctaactcactttttattgatacctttg |
185 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||| ||||||||||||||| |||| |||| ||| ||||||||| |||||||||||| |
|
|
| T |
29835505 |
tataaatgttacagcttgcttgttgctaaacaca--gtatagttattggaaggctatgtgcattctgtaattcactttttgttgatacctttg |
29835415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University