View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15395_high_15 (Length: 410)
Name: NF15395_high_15
Description: NF15395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15395_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 16 - 366
Target Start/End: Complemental strand, 16329443 - 16329092
Alignment:
| Q |
16 |
gtctcttctctaaatcaaggccatgcgttctgctcccaagttaagaccatttttaggcatatgtccgtccattgtgtccttagagtacttgcccttccnn |
115 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16329443 |
gtctcttctctaaatcaaggccatgagttctgctcccaagttaagaccatttttaggcacatgtccgtccattgtgtccttagagtacttgcccttcctt |
16329344 |
T |
|
| Q |
116 |
nnnnn-gaaggcaacaaaatcgtccttttatggcattatctattgtctcagacattctatccaatatagagaatgcttcttacatttattctttgactga |
214 |
Q |
| |
|
| ||| |||||| |||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
16329343 |
ttttttgtagggaacaaagtcgtccttttatggcattatctgttgtctcagacattctgtccaatatagagaatgcttcttacatttattctttgactaa |
16329244 |
T |
|
| Q |
215 |
aaaatgtggaatttgactatgtcgtgctaacaaaacgtttcaatttactttctaggttttgtgggataactgctcctgcaaatttcggttttatgatgca |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
16329243 |
aaaatgtggaatttgactatgtcgtgctaacaaaacgtttcaatttactttctaggttttgtgggatacctgctcctgcaaatttcggttttatgataca |
16329144 |
T |
|
| Q |
315 |
atcacattattattttctttcagcgaagtttatttatgagtcttatttactc |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16329143 |
atcacattattattttctttcagcgaagtttatttatgagtcttatttactc |
16329092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University