View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15395_high_17 (Length: 385)
Name: NF15395_high_17
Description: NF15395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15395_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 4e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 11 - 151
Target Start/End: Complemental strand, 41782255 - 41782115
Alignment:
| Q |
11 |
cacagaagcatatcatgtaccattaacttcctacaacaacaaaagcaagcattaacgaatcttttcaagccccgaacagtctcatatcaaacaaaatgaa |
110 |
Q |
| |
|
|||| ||| |||||||||||||| |||| |||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41782255 |
cacataagtatatcatgtaccatcaactccctacaacgacaaaagcaagtattaacgaatcttttcaagccccaaacagtctcatatcaaacaaaatgaa |
41782156 |
T |
 |
| Q |
111 |
tgactaggatattacaattgtccaaatttagtcacaagaca |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41782155 |
tgactaggatattacaattgtccaaatttagtcacaagaca |
41782115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University