View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15395_high_18 (Length: 377)
Name: NF15395_high_18
Description: NF15395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15395_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 6e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 208 - 337
Target Start/End: Complemental strand, 35261204 - 35261072
Alignment:
| Q |
208 |
aatatcatatgtaaatcaaagtaaagacttggccatctaaaatcctacccttccaaaatctcctctcaaagagactct---ttgtcagtctcctagtgta |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35261204 |
aatatcatatgtaaatcaaagtaaagacttggccatctaaaatcctccccttcaaaaatctcctctcaaagagactcttagttgtcagtctcctagtgta |
35261105 |
T |
 |
| Q |
305 |
ggtcacatttctaacccatgcattcttaggtcc |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35261104 |
ggtcacatttctaacccatgcattcttaggtcc |
35261072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 36 - 142
Target Start/End: Complemental strand, 35261376 - 35261270
Alignment:
| Q |
36 |
gaacacaatgtaattagaccgattatgaaactaatttcaactgctttggattctatctcttgggtcttttgaatggagcgtttagaaggagattatgaat |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35261376 |
gaacacaatgtaattagaccgattatgaaactaatttcaactgctttggattctatctcttgggtcttttgaatggagcgtttagaaggagattatgaat |
35261277 |
T |
 |
| Q |
136 |
gctataa |
142 |
Q |
| |
|
||||||| |
|
|
| T |
35261276 |
gctataa |
35261270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University