View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15395_high_34 (Length: 255)
Name: NF15395_high_34
Description: NF15395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15395_high_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 14 - 237
Target Start/End: Complemental strand, 34880530 - 34880307
Alignment:
| Q |
14 |
aatatggcatttgcaatacgtcgatgatactctatgtatatgggagccaatggtggataattttggacattgaaagcattattgagaggattcgaaatga |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34880530 |
aatatcgcatttgcaatacgtcgatgatactctatgtatatgggagccaatggtggataattttggacattgaaagcattattgagaggattccaaatgg |
34880431 |
T |
 |
| Q |
114 |
tgctaggttcggaagtcaattttcacaaaaggaagtcacaaaaattgttgggtcaaatggaggaaggtttgccaaccaagaagttagaggggtttggggc |
213 |
Q |
| |
|
|| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34880430 |
tgtcagggtcggaagtcaattttcacaaaaggaagtcacaaaaattgttgggtcaaatggaggaaggtttgccaaccaagaagttagaggggtttggggc |
34880331 |
T |
 |
| Q |
214 |
gaaagatgttagggtggttaatat |
237 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
34880330 |
gaaagatgttagggtggttaatat |
34880307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 158 - 195
Target Start/End: Original strand, 36987975 - 36988012
Alignment:
| Q |
158 |
ttgttgggtcaaatggaggaaggtttgccaaccaagaa |
195 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
36987975 |
ttgttgggtgaaatggaggaaggtttgccaacctagaa |
36988012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University