View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15395_low_14 (Length: 416)
Name: NF15395_low_14
Description: NF15395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15395_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 11 - 252
Target Start/End: Complemental strand, 53660485 - 53660244
Alignment:
| Q |
11 |
catagggttggttacttctaaatttttaaatgtataacctacaggtttggatgaggaagtttaagacgaacctagacaagttggaatgagaatgacggct |
110 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53660485 |
catagggttggttacttctaaattttaaaatgtataacctacaggtttggatgaggaagtttaagacgaacctagactagttggaatgagaatgacggct |
53660386 |
T |
|
| Q |
111 |
tttatgctgaaaattgaataattggaactgaatatctattaaagctaacatgaattttagnnnnnnncgttgcttatacgctttgcaaatagataataac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
53660385 |
tttatgctgaaaattgaataattggaactgaatatctattaaagctaacatgaattttagtttttttcgttgcttatacgctttgcaaatagataataac |
53660286 |
T |
|
| Q |
211 |
aattttgttccctattttataaacctcaccatctctcttgtt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
53660285 |
aattttgttccctattttataaacctcaccctctctcttgtt |
53660244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 249 - 401
Target Start/End: Complemental strand, 53660208 - 53660055
Alignment:
| Q |
249 |
tgttcgtcctaacgaaataagtatctcactgannnnnnngtgacataggtcacattgaccaaatcgcgtaaacttttgtgtcttgttctttcctcttttt |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53660208 |
tgttcgtcctaacgaaataagtatctcactgatttctttgtgacgtaggtcacattgaccaaatcgcgtaaacttttgtgtcttgttctttcctcttttt |
53660109 |
T |
|
| Q |
349 |
cctttgatcttccaacttgtgtgtggtttattcttgtcttt-gtcaaaacaatt |
401 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
53660108 |
cctttgatcttccgacttgtgtgtggtttattcttgtctttggtcaaaacaatt |
53660055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University