View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15395_low_25 (Length: 350)
Name: NF15395_low_25
Description: NF15395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15395_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 8e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 66 - 173
Target Start/End: Original strand, 49620158 - 49620265
Alignment:
| Q |
66 |
gaccaaggtcctttgatttggttttattatgtcgtgttattattattcagatttagtttccttttttgacaaatttgctggaattttgactcggatgttt |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
49620158 |
gaccaaggtcctttgatttggttttattatgtcgtgttattattattcagatttagtttccttttttgacaaatttgctgggattttgactcggatgttt |
49620257 |
T |
|
| Q |
166 |
aacaaagg |
173 |
Q |
| |
|
|||||||| |
|
|
| T |
49620258 |
aacaaagg |
49620265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 198 - 292
Target Start/End: Original strand, 49620316 - 49620410
Alignment:
| Q |
198 |
ggttttaattgggtggagagattctagccagggaataattgttgctttttcttttgtagctcttcgtggtgttcacatagtcacgtataaataga |
292 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
49620316 |
ggttttaattgggcggagagattctagccagggaataattgttgctttttcttttgtagctcttcgtggtgttcacagagtcacatataaataga |
49620410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University