View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15395_low_26 (Length: 350)
Name: NF15395_low_26
Description: NF15395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15395_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 19 - 188
Target Start/End: Complemental strand, 7691630 - 7691461
Alignment:
| Q |
19 |
agatactactcattctcatttcactttatgctctctctttcttcccaatatcatactccacaggttagcagtttacagcaaaatggttttaaattgcggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7691630 |
agatactactcattctcatttcactttatgttctctctttcttcccaatatcatactccacaggttagcagtttacagcaaaatggttttaaattgcggt |
7691531 |
T |
 |
| Q |
119 |
cgcaatataaactttgatgttaccatacaatgcggataaatatgcccgcagttgtattttcaatgtcgtt |
188 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
7691530 |
cgcaatataaactttgatattacgatacaatgcggataaatatgaccgcaattgtattttcaatgtcgtt |
7691461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 187 - 340
Target Start/End: Complemental strand, 7691436 - 7691283
Alignment:
| Q |
187 |
ttacagccagagaattgcagttgcagaccgcaatttagaactattagcattgcagttcttccgtcttaattttcttgttaagaatattataacaagttat |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7691436 |
ttacagccagagaattgcagttgcagaccgcaatttagaactattagcattgcaattcttttgtcttaattttcttgttaagaatattataacaagttat |
7691337 |
T |
 |
| Q |
287 |
gaagatgtttatcatttttattgttctatcacagatagatcacaattgcctatg |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7691336 |
gaagatgtttatcatttttattgttctatcacagatagatcacaattgcctatg |
7691283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 4e-23; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 19 - 118
Target Start/End: Complemental strand, 13890357 - 13890258
Alignment:
| Q |
19 |
agatactactcattctcatttcactttatgctctctctttcttcccaatatcatactccacaggttagcagtttacagcaaaatggttttaaattgcggt |
118 |
Q |
| |
|
|||||||| |||||||||||||||| ||| ||||||||||||||||| ||||||| |||||||||| || |||||| ||| |||||| ||||||||||| |
|
|
| T |
13890357 |
agatactagtcattctcatttcactctatactctctctttcttcccattatcatatcccacaggttaccactttacaccaacatggttctaaattgcggt |
13890258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 19 - 118
Target Start/End: Complemental strand, 14030482 - 14030383
Alignment:
| Q |
19 |
agatactactcattctcatttcactttatgctctctctttcttcccaatatcatactccacaggttagcagtttacagcaaaatggttttaaattgcggt |
118 |
Q |
| |
|
|||||||| |||||||||||||||| ||| ||||||||||||||||| ||||||| |||||||||| || |||||| ||| |||||| ||||||||||| |
|
|
| T |
14030482 |
agatactagtcattctcatttcactctatactctctctttcttcccattatcatatcccacaggttaccactttacaccaacatggttctaaattgcggt |
14030383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University