View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15395_low_30 (Length: 339)
Name: NF15395_low_30
Description: NF15395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15395_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 57 - 201
Target Start/End: Complemental strand, 44691351 - 44691207
Alignment:
| Q |
57 |
tatatatgcattgtaaaacaattttagatttgtaatggtggtctatatgctcaagttttattagggctaatttttatttgtagataggtttgattgtcta |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44691351 |
tatatatgcattgtaaaacaattttagatttgtaatggtggtctatatgctcaagttttattagggctaatttttatttgtagataggtttgattgtcta |
44691252 |
T |
|
| Q |
157 |
ccgattgttttacataactttgttgggtttgttttgttcccccta |
201 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44691251 |
tcgattgttttatataactttgttgggtttgttttgttcccccta |
44691207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 242 - 331
Target Start/End: Complemental strand, 44691172 - 44691083
Alignment:
| Q |
242 |
atattgtatatgatagtacgagtgccttggacacattgtgttgaggtgtaaatatagctgagatttcaatcatcataactaattcatctc |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44691172 |
atattgtatatgatagtacgagtgccttggacacattgtgttgaggtgtcaatatagctgagatttaaatcatcataactaattcatctc |
44691083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University