View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15395_low_41 (Length: 241)
Name: NF15395_low_41
Description: NF15395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15395_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 131 - 231
Target Start/End: Original strand, 40677450 - 40677549
Alignment:
| Q |
131 |
cgttatttttccgtggcatacgggttttataacgatccatatcagatactccatttaaaaatatgacaagtcatcgtgtgagcgcatgtatatttccttt |
230 |
Q |
| |
|
||||| ||||||||| | |||||||||||||||||||||||||| ||| |||||| |||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
40677450 |
cgttaattttccgtgacttacgggttttataacgatccatatcacctaccccattttaaaatatgacaagtcatcgtgtgaatg-atgtatatttccttt |
40677548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 40677371 - 40677412
Alignment:
| Q |
16 |
caagtttcaccttccttctcgtcatggttgcaaaacaactgc |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40677371 |
caagtttcaccttccttctcgtcatggttgcaaaacaactgc |
40677412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University