View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15395_low_44 (Length: 234)
Name: NF15395_low_44
Description: NF15395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15395_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 5 - 217
Target Start/End: Original strand, 1287724 - 1287936
Alignment:
| Q |
5 |
gaattctaaaacttcgacattacatagcaacatactcaaaggaagcatgaccagcgaaaatttgcatgaatcatagtgtttgtaagagtgtcctcttgca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1287724 |
gaattctaaaacttcgacattacatagcaacatacttaaaggaagcatgaccagcgaaaatttgcatgaatcatagtgtttgtaagagtgtcctcttgca |
1287823 |
T |
 |
| Q |
105 |
acctcttgaaaccaaagcaaaaatacatggtacatcagtagaagagcaagcattacaggcaaaacttgtagcgtagtactcgatcgtgctcagtccattt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1287824 |
acctcttgaaaccaaagcaaaaatacatggtacatcagtagaagagcaagcattacaggcaaaacttgtagcgtagtactcgatcgtgctcagtccattt |
1287923 |
T |
 |
| Q |
205 |
tagagaatgaact |
217 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1287924 |
tagagaatgaact |
1287936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University