View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15395_low_45 (Length: 228)
Name: NF15395_low_45
Description: NF15395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15395_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 15 - 142
Target Start/End: Original strand, 11625156 - 11625280
Alignment:
| Q |
15 |
gataattctgattcgaagatgaaaagggtggtgtaataaacagaaataataaaagaaaatgtttgtgagtggattgattcattgactgtatattagaata |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11625156 |
gataattctgattcgaagatgaaaagggtggtgtaataaacagaaata---aaagaaaatgtttgtgagtggattgattcattgactgtatattagaata |
11625252 |
T |
 |
| Q |
115 |
ttggacgtcattttcactgactacaaat |
142 |
Q |
| |
|
|||||||||||||||||||||| ||||| |
|
|
| T |
11625253 |
ttggacgtcattttcactgacttcaaat |
11625280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 138 - 176
Target Start/End: Original strand, 11626040 - 11626078
Alignment:
| Q |
138 |
caaatacttagggaagtggaaatgctgaggcattcttaa |
176 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
11626040 |
caaatacttagtgaagtggaaatgctgagacattcttaa |
11626078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University