View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15395_low_46 (Length: 219)
Name: NF15395_low_46
Description: NF15395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15395_low_46 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 49620084 - 49619906
Alignment:
| Q |
1 |
aggtaaaaattccatcttttcgttctcctagtttttaccctttacattaattaattaaatccaaaccctaatatcaattaatcacactctattatactct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49620084 |
aggtaaaaattccatcttttcgttctcctagtttttaccctttacattaattaattaaatccaaaccctaatatcaattaatcaca--ctattatactct |
49619987 |
T |
|
| Q |
101 |
gtttacttattaattaacaggggtaaagtaaatgcaagtttgatttcgtgttgcaatagtccgaaaagggaaaaagttagg |
181 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49619986 |
gtttacttattaattaacaggggtaaaggaaatgcaagtttgatttcgtgttacaatagtccgaaaagggaaaaagttagg |
49619906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University