View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15396_high_26 (Length: 227)
Name: NF15396_high_26
Description: NF15396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15396_high_26 |
 | |
|
| [»] scaffold0272 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0272 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: scaffold0272
Description:
Target: scaffold0272; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 24 - 132
Target Start/End: Complemental strand, 6388 - 6280
Alignment:
| Q |
24 |
gcaatgacatggttacaaacacagaagcagcgatcgtggggatatcaacgctctacatcttgtttaagtatttgatgttttccatgtcgatcttcagtat |
123 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6388 |
gcaacgacatggttacaaacgtagaagcagcgatcgtggggatatacatgctctacatcttgtttaagtatttgatgttttccatgtcgatcttcagtat |
6289 |
T |
|
| Q |
124 |
taaatatgt |
132 |
Q |
| |
|
||||||||| |
|
|
| T |
6288 |
taaatatgt |
6280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 227
Target Start/End: Complemental strand, 5710 - 5669
Alignment:
| Q |
186 |
ttattcaacaaaagatggaaaaaatttaaagactccaattat |
227 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
5710 |
ttattcaacaaaagattgaaaaaatttagagactccaattat |
5669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 121 - 160
Target Start/End: Original strand, 21139233 - 21139272
Alignment:
| Q |
121 |
tattaaatatgtggaaaagaggagtgccgtttcaaatata |
160 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
21139233 |
tattaaatatgtggaaaagaggagtgtcatttcaaatata |
21139272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University