View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15396_high_27 (Length: 220)
Name: NF15396_high_27
Description: NF15396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15396_high_27 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 39727289 - 39727508
Alignment:
| Q |
1 |
ttggtaaccctaagttatccnnnnnnncagtatcctttcattacatatgacaccattggagttattttaagatgatgtttctcaataagtctcacaaaat |
100 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39727289 |
ttggtaagcctaagttatccaaaaaaacagtatcctttcattacatatgacaccattggagttattttaagatgatgttgctcaataagtctcacaaaat |
39727388 |
T |
 |
| Q |
101 |
aacctttggcggaaatctttattggagtttttctgnnnnnnnggtaagcattgaagttactcatataaatttccacatatctgttttggactctttttac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39727389 |
aacctttggcggaaatctttattggagtttttctgttttttgggtaagcattgaagttactcatataaatttccacatatctgttttggactctttttac |
39727488 |
T |
 |
| Q |
201 |
aagtgtcccaaggtcacccc |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
39727489 |
aagtgtcccaaggtcacccc |
39727508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University