View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15396_low_17 (Length: 360)
Name: NF15396_low_17
Description: NF15396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15396_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 8e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 172 - 343
Target Start/End: Original strand, 17113133 - 17113308
Alignment:
| Q |
172 |
tcaatatatcctatctccagcatcttcattcactttcattatccttaaccgaataaaccaattaactaattagaatccttaccgttt----tattttact |
267 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
17113133 |
tcaatatatcctatctccagcatcatcattcactttcattatccttaaccgaataaaccaattaactaattagaatccttaccgttttatatattttact |
17113232 |
T |
 |
| Q |
268 |
gttttaatgcaatgttggtttaaatgggaacatacaccaaaagtttctttacgagagtttttgcttattacttttt |
343 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17113233 |
gttttaatgcaatgttggtttaaatcggaacatacaccaaaagtttctttacgagagtttttgcttattacttttt |
17113308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 16 - 101
Target Start/End: Original strand, 17112962 - 17113047
Alignment:
| Q |
16 |
atataggggggaggattgaatacgcaaaagtaaatggggaatagggaactcattcttatatcctataaggtttttatattggactc |
101 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17112962 |
atataggagggaggattgaatacgcaaaagcaaatggggaatagggaactcattcttatatcctataagatttttatattggactc |
17113047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University