View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15396_low_22 (Length: 286)
Name: NF15396_low_22
Description: NF15396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15396_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 33051714 - 33051989
Alignment:
| Q |
1 |
accgagtctgaaagaactctttaannnnnnngtggctcaaatttcctaaatcattgattgtcaaattaagtctagacccttcacccctttttgtttcgtc |
100 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33051714 |
accgagtctgaaagaactcttcaatttttttgtggctcaaatttcctaaatcattgattgtcaaattaagtctagaaccttcacccctttttgtttcgtc |
33051813 |
T |
 |
| Q |
101 |
ctggctagtctagttaatt-accagaaacaaagtttctaaatctcttgggggtaaccataaaaactccaagttatttgcacactttataccaaatattat |
199 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33051814 |
ctggctagtctagttaatttaccagaaacaaagtttctaaatctcttgggggtaaccataaaaactccaagttatttgcacactttatacaaaatattaa |
33051913 |
T |
 |
| Q |
200 |
tccaaacttcgcacaaagaataaatgttgttccaattcttgattccaagagcacaaacacaagtagtagcattcat |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33051914 |
tccaaacttcgcacaaagaataaatgttgttccaattcttgattccaagagcacaaacacaagtagtagcattcat |
33051989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University