View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15396_low_30 (Length: 231)
Name: NF15396_low_30
Description: NF15396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15396_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 11 - 213
Target Start/End: Original strand, 9050170 - 9050373
Alignment:
| Q |
11 |
gtgagatgaaattgaaaagtacctttt-ttctctcttgatgtgtgtgtgtaaaccttgaaggcaagaagagcacttcgtgcgcttaaggggttagtgaag |
109 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9050170 |
gtgatatgaaattgaaaagtacctttttttctctcttgatgtgtgtgtgtaaactttgaaggcaagaagagcactccgtgcgcttaaggggttagtgaag |
9050269 |
T |
 |
| Q |
110 |
ttgcaagctttagtgagaggtcacaatgttcggaagcaagcaaagatgacacttaggtgcatgcaagctcttgttagagtacaagcaagagttcttgacc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9050270 |
ttgcaagctttagtgagaggtcacaatgttaggaagcaagcaaagatgacacttaggtgcatgcaagctcttgttagagtacaagcaagagttcttgacc |
9050369 |
T |
 |
| Q |
210 |
aaag |
213 |
Q |
| |
|
|||| |
|
|
| T |
9050370 |
aaag |
9050373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University