View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15397_low_6 (Length: 262)
Name: NF15397_low_6
Description: NF15397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15397_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 23617294 - 23617043
Alignment:
| Q |
1 |
ttttggattttgagggtaatagcttatttcatgactttgtggttgtggtacgcagtatgatgcacgcatagctgaaaaccaaaaataatacttcaattac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23617294 |
ttttggattttgagggtaatagcttatttcatgactttgtggttgtggtacgcaatatggtgcacgcatagctgaaaaccaaaaataataattcaattac |
23617195 |
T |
|
| Q |
101 |
caatgttacagtagaatactaggatgtaaagtaaggaaagaaataagtaa---tagtggggnnnnnnnnnctttattagattaaaatgtatatttaattt |
197 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23617194 |
caatgttacagtacaatactaggatgtaaagtaaagaaagaaataagtaatactagtggggaaaaaaaaactttattagattaaaatgtatatttaattt |
23617095 |
T |
|
| Q |
198 |
gtaacaaaaacacaaagcaaatattatcactccatctttag-tatgtttctg |
248 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| | |||||||||| |
|
|
| T |
23617094 |
gtaacaaaaacacaaagcaaatataatcactccatctttggttatgtttctg |
23617043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University