View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15399_high_1 (Length: 871)
Name: NF15399_high_1
Description: NF15399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15399_high_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 308; Significance: 1e-173; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 446 - 855
Target Start/End: Original strand, 40173047 - 40173458
Alignment:
| Q |
446 |
cctgattagcgggact--atgtttcattcaaaaacttgttttgacaatgttattttaaatattttgttgtgtcggttattgagggatttaaatactcatg |
543 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40173047 |
cctgattggcgggactttatgtttcattcaaaaactcgttttgacaatgttattttaaatattttgttgtgtcggttattgagagatttaaatactcatg |
40173146 |
T |
|
| Q |
544 |
ttaggagaggtaaagatgccatagcaatggaagtaggattcattgttatttgtataggattcagtgaacttgcnnnnnnnnnnnnnnnactcatgaggga |
643 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40173147 |
ttaggagaggtaaagatgccatagcaatggaagtaggattcattgttatttgtataggattcagtgaacttgcttttttctcttttttcctcatgaggga |
40173246 |
T |
|
| Q |
644 |
aaaccagaagaacagtatccttcattgagtttcctttcaaatggttttcacttaatttctctctccattgtaggttgctgacgagtacagacttctacct |
743 |
Q |
| |
|
| |||||||||| |||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40173247 |
acaccagaagaattgtatccttcattaagtttcttttcaaatggttttcacttaatttctctctccattgtaggttgctgacgagtacagactcctacct |
40173346 |
T |
|
| Q |
744 |
gatacactatttttggcagttaactaccttgatcgctatctttcaggcaaagcaatgaacacacagcagttacaactgcttggtgttacctgcatgatga |
843 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40173347 |
gatacactatttttggcagttaactaccttgatcgctatctttcaggcaaagcaatgaacacgcagcagttacaactacttggtgttacctgcatgatga |
40173446 |
T |
|
| Q |
844 |
ttgctgcgtagg |
855 |
Q |
| |
|
|||||||||||| |
|
|
| T |
40173447 |
ttgctgcgtagg |
40173458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 150; E-Value: 8e-79
Query Start/End: Original strand, 232 - 397
Target Start/End: Original strand, 40172833 - 40172998
Alignment:
| Q |
232 |
agaaatttaaaaggccatctatggactacatggagaagatacagaaaaacatcaatgctagcatgcgggcaatgcttattgattggctcgtggaggtaaa |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40172833 |
agaaatttaaaaggccatctatggactacatggagaagatacagaaaaagatcaatgctagcatgcgggcaatgcttattgattggcttgtggaggtaaa |
40172932 |
T |
|
| Q |
332 |
ctatggtgggtgatggactgccggggtgatagatttattccaggggatttgttcttctcaatgtgc |
397 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40172933 |
ttatggtgggtgacggactgccggggtgatagatttattccaggggatttgttcttctcaatgtgc |
40172998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 134; E-Value: 3e-69
Query Start/End: Original strand, 1 - 142
Target Start/End: Original strand, 40172558 - 40172699
Alignment:
| Q |
1 |
tccctcttaaaagggctaatgtcttctatttttacacaatatgaaaagataaattactaaattggtatgagatatagcttttcaaatttccaaactcagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40172558 |
tccctcttaaaagggctaatgtcttctatttttacacaatatgaaaagataaattactaaattggtatgagatatagcttttcaaacttccaaactcagg |
40172657 |
T |
|
| Q |
101 |
tttttctatcatatcgtttatgcagttatgcctgtggtttag |
142 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40172658 |
tttttctatcatatcatttatgcagttatgcctgtggtttag |
40172699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University