View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15399_high_21 (Length: 238)
Name: NF15399_high_21
Description: NF15399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15399_high_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 13 - 221
Target Start/End: Original strand, 33966496 - 33966704
Alignment:
| Q |
13 |
aatatgtcttccatcgaagcttatctactactcaagtccaatcaattgattaccttaacatacatattttatcacaatttttcgcaatatcaagaattcc |
112 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33966496 |
aatatgtcttccatccaagcttatctactactcgagtccaatcaattgattaccttaacatacatattttatcacaatttttcgcaatatcaagaattcc |
33966595 |
T |
 |
| Q |
113 |
gacgtgaccgcaaattaaaaactttggacacaatcacaccacaaacaaaggaaaatgagataaagtatagtactactcacgtgtaaactcctgcatgaac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33966596 |
gacgtgaccgcaaattaaaaactttggacacaatgacaccacaaacaaaggaaaatgagataaagtatagtactactcacgtgtaaactcctgcatgaac |
33966695 |
T |
 |
| Q |
213 |
cttgatgac |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
33966696 |
cttgatgac |
33966704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University