View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15399_high_23 (Length: 234)
Name: NF15399_high_23
Description: NF15399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15399_high_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 66 - 216
Target Start/End: Original strand, 22599611 - 22599761
Alignment:
| Q |
66 |
ataaaataacatatcaaaattgttatgcgactttggtgagtggaaattcagcacctttttagagtctagtatatattaagcttttgattacatggaaaat |
165 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22599611 |
ataaaataacatataaaaattgttatgcgactttgttgagtggaaattcagcacctttttagagtctagtatatattatgcttttgattacatggaaaat |
22599710 |
T |
|
| Q |
166 |
ggaaaataaaagcaaaatggtgtaggtaggttagggtttaggagtaggaat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22599711 |
ggaaaataaaagcaaaatggtgtaggtaggttagggtttaggagtaggaat |
22599761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University