View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15399_low_25 (Length: 237)
Name: NF15399_low_25
Description: NF15399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15399_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 81 - 221
Target Start/End: Complemental strand, 1476775 - 1476635
Alignment:
| Q |
81 |
gaaattcttctataaaatgatacatgacatataactttaaacccctattttcttcacatgacaattttgtttattactattaatttttcaagaagtaatc |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1476775 |
gaaattcttctataaaatgatacatgacatataactttaaacccctattttcttcacatgacaattttgtttattactattattttttcaagaagtaatc |
1476676 |
T |
 |
| Q |
181 |
atcattattggaataatgttagttatttaataactgaaaac |
221 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
1476675 |
atcattattggaattatgttagttatttaataactaaaaac |
1476635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 1476870 - 1476804
Alignment:
| Q |
1 |
ctagagaatctaagtttgtgttttatgttttgaacaagtttatattgttatgttatgttatcaatcc |
67 |
Q |
| |
|
||||||||||||| || ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1476870 |
ctagagaatctaaattcgtgttttgtgttttgaacaagtttatattgttatgttatgttatcaatcc |
1476804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University