View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1539_high_12 (Length: 299)
Name: NF1539_high_12
Description: NF1539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1539_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 135 - 283
Target Start/End: Complemental strand, 41130942 - 41130794
Alignment:
| Q |
135 |
tgctaacctagtttacctcctctttgatatcgtctccaaatcataattactattatagtctcttccttcaaaacggtacgttccatctttcttatttggt |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41130942 |
tgctaacctagtttacctcctctttgatatcgtctccaaatcataattactattatagtctcttccttcaaaacggtacgttccatctttcttatttaat |
41130843 |
T |
|
| Q |
235 |
tttaataattatattgatcgatctgtccttttatctttaaccttcatgt |
283 |
Q |
| |
|
||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41130842 |
ttttataattatattgatcgatttgtccttttatctttaaccttcatgt |
41130794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 8 - 64
Target Start/End: Complemental strand, 41131069 - 41131013
Alignment:
| Q |
8 |
gagcagagatgctagtggtgttaattataggctctccctttgcaataattctcacaa |
64 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41131069 |
gagcaaagatgctagtggtgttaattataggctctccctttgcaataattctcacaa |
41131013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University