View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1539_low_10 (Length: 393)
Name: NF1539_low_10
Description: NF1539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1539_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 6e-56; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 244 - 378
Target Start/End: Original strand, 16832268 - 16832402
Alignment:
| Q |
244 |
tatttctttttccgaataaagaaaattcgagtgctaaactaaaggttaacaatatcaagaaatcactctatcaggttagtgtataggaaagtagaatatc |
343 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16832268 |
tatttcgttttccgaataaagaaaattcaagtgctaaactaaaggttaacaatatcaagaaatcactctatcaggttagtttataggaaagtagaatatc |
16832367 |
T |
|
| Q |
344 |
aacataaaatataccagggaacaaggtgtttaact |
378 |
Q |
| |
|
|||| ||||| |||||||||| ||||||||||||| |
|
|
| T |
16832368 |
aacacaaaatgtaccagggaataaggtgtttaact |
16832402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 222
Target Start/End: Original strand, 16978088 - 16978144
Alignment:
| Q |
166 |
caaaattttgtttcgcaacctttcaaaccgatcaaaagctttttccttataggtgag |
222 |
Q |
| |
|
||||| |||| ||||||||||||| ||||||| ||||||||| | |||||||||||| |
|
|
| T |
16978088 |
caaaaatttgattcgcaacctttctaaccgatgaaaagctttcttcttataggtgag |
16978144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University