View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1539_low_17 (Length: 256)
Name: NF1539_low_17
Description: NF1539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1539_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 17 - 244
Target Start/End: Complemental strand, 45127591 - 45127366
Alignment:
| Q |
17 |
actaattactattaataaataactttgatttacagtggtggtagcatagcatatcatagcatggtgccaaactttgcagaaccccacacccacaccacct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45127591 |
actaattactattaataaataactttgatttacagtggtggtagcatagcatatcatagcatagtgccaaactttgcagaaccccacacccacaccacct |
45127492 |
T |
 |
| Q |
117 |
ttattttccctttccctttcctttgcttgtgagttctgtcccaatacagggggctaccacacccatatctcnnnnnnnnnnnnnnnncctttcattgaag |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45127491 |
ttattttccctttccctttcctttgcttgtgagttctgtcccaatacagggggctaccacacccatatctc--ttcttttcttttttcctttcattgaag |
45127394 |
T |
 |
| Q |
217 |
aagaaaaccacattcacattcacattca |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
45127393 |
aagaaaaccacattcacattcacattca |
45127366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University