View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1539_low_19 (Length: 246)
Name: NF1539_low_19
Description: NF1539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1539_low_19 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 19 - 246
Target Start/End: Original strand, 38954379 - 38954606
Alignment:
| Q |
19 |
ggtgtggcatgaaaacagatagacgtggctgtagaattaacttttctcactattctccggaagcaaaaagcaagctagaggttgcttctgaggttagaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38954379 |
ggtgtggcatgaaaacagatagacgtggctgtagaattaacttttctcactattctccggaagcaaaaagcaagctagaggttgcttctgaggttagaga |
38954478 |
T |
|
| Q |
119 |
tacagaacgattttctcttggtaattggttcttcattgatggtacatgccgaggttctacttctatgacatggcctgaggagaaacttccaacatgggat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38954479 |
tacagaacgattttctcttggtaattggttcttcattgatggtacatgccgaggttctacttctatgacatggcctgaggagaaacttccaacatgggat |
38954578 |
T |
|
| Q |
219 |
ttacctcttgtagaagatgaatgtgatc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
38954579 |
ttacctcttgtagaagatgaatgtgatc |
38954606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 123 - 240
Target Start/End: Original strand, 43763795 - 43763906
Alignment:
| Q |
123 |
gaacgattttctcttggtaattggttcttcattgatggtacatgccgaggttctacttctatgacatggcctgaggagaaacttccaacatgggatttac |
222 |
Q |
| |
|
||||| |||||| |||||| |||||||| |||||||||| |||||||||| ||||||||||||||| || ||||||||||| | ||||||| || |
|
|
| T |
43763795 |
gaacgtttttcttttggtagttggttctccattgatggttcatgccgagg------ttctatgacatggcccgaagagaaacttcccagttgggattcac |
43763888 |
T |
|
| Q |
223 |
ctcttgtagaagatgaat |
240 |
Q |
| |
|
||||| ||||| ||||| |
|
|
| T |
43763889 |
ctctttcagaagttgaat |
43763906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University