View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15401_high_36 (Length: 288)
Name: NF15401_high_36
Description: NF15401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15401_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 44581464 - 44581735
Alignment:
| Q |
1 |
aatcacattacttgaaggctgtgctaattggggcagtggcaactttgggccttgcacttatcataaccctttcattactctgggttcgttcgtcgtcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44581464 |
aatcacattacttgaaggctgtgctaattggggcagtggcaactttgggccttgcacttatcataaccctttcattactctgggttcgtttgtcgtcaaa |
44581563 |
T |
 |
| Q |
101 |
gaaggaaagagctgttaggaaatacacagaagtcaagaagcaagttgatccattagcaagtaagagcgatgtctcaattacaacaaactcccattaaaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44581564 |
gaaggaaagagctgttaggaaatacacagaagtcaagaagcaagttgatccatcagcaagtaagagcgatgtctcaattacaacaaactcccattaaaag |
44581663 |
T |
 |
| Q |
201 |
cagaagnnnnnnnngaatcccgtcttgataaacgctaacctaatcttttaacaggtgctaaacttattacct |
272 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44581664 |
cagaagaaaaaaaagaatctcgtcttgataaacgctaacctaatcttttaacaggtgctaaacttattacct |
44581735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University