View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15401_high_44 (Length: 256)
Name: NF15401_high_44
Description: NF15401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15401_high_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 38446669 - 38446906
Alignment:
| Q |
1 |
ttttccctggtccaaaacagagtggtactgtttcagttggtgagattgagaaacggttgaagatgcgtgggattcatgaaccttctaaagatcttgatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38446669 |
ttttccctggtccaaaacagagtggtactgtttcagttggtgagattgagaaacggttgaagatgcgtgggattcatgaaccttctaaagatcttgatac |
38446768 |
T |
 |
| Q |
101 |
actaaaacaaatccttgaagcgttgcagctgaaaggactattacattctaagaaatcagtgaatgtaacaaaccaaagaaactttgttattgagaatgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38446769 |
actaaaacaaatccttgaagcgttgcagttgaaaggactattacattctaagaaatcagtgaatgtaacaaaccaaagaaactttgttattgagaatgtg |
38446868 |
T |
 |
| Q |
201 |
aatgattctcattccccaattgtggttatgaaaccagg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38446869 |
aatgattctcattccccaattgtggttatgaaaccagg |
38446906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 42 - 103
Target Start/End: Complemental strand, 31486172 - 31486111
Alignment:
| Q |
42 |
gagattgagaaacggttgaagatgcgtgggattcatgaaccttctaaagatcttgatacact |
103 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| | |||||||| |||||||||| ||||| |
|
|
| T |
31486172 |
gagattgagaaaaggttgaagatgcgtgggattaaccaaccttctcaagatcttgacacact |
31486111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University