View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15401_high_51 (Length: 247)
Name: NF15401_high_51
Description: NF15401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15401_high_51 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 58 - 230
Target Start/End: Original strand, 35454713 - 35454890
Alignment:
| Q |
58 |
aaatatgtattttgaattctggcaataataca----agttaagaaatgtct-tgtcatttgagcatgtcacgttatattagagttgcattcaatatgaga |
152 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||| ||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
35454713 |
aaatatgtattttgaattttggcaataatacatacaagttaagaaatgtctctgtcatttgagcacgtcatgttatattagagttgcattcaatatgaga |
35454812 |
T |
|
| Q |
153 |
aagtataaagaaatttacaagcatggattcttgatccattggaatttggtggtgatggagcatcaagataatgaaatt |
230 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35454813 |
aagtataaagaaatttacaatcatggattcgtgatctattagaatttggtggtgatggagcatcaagataatgaaatt |
35454890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University