View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15401_high_57 (Length: 233)
Name: NF15401_high_57
Description: NF15401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15401_high_57 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 215
Target Start/End: Original strand, 22867688 - 22867890
Alignment:
| Q |
13 |
gatgaatatgaatgaagacgaagtttaactagaaagtgatggtctcgagcaccatgcgagtgacctttcagcagcacgcaacaatggattgtcacaacca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22867688 |
gatgaatatgaatgaagacgaagtttaactagaaagtgatggtctcgagcaccatgcgagtgacctttcagcagcacgcaacaatggattgtcacaacca |
22867787 |
T |
 |
| Q |
113 |
gaagaataccttccattgattcttgaccaccaaagcacataagaccttccagtgatggtttccaatgtcgttaaccgtcctccagctgttcgatgaaatg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22867788 |
gaagaataccttccattgattcttgaccaccaaagcacataagaccttccagtgatggtttccaatgtcgctaaccgtcctccagctgttcgatgaaatg |
22867887 |
T |
 |
| Q |
213 |
cca |
215 |
Q |
| |
|
||| |
|
|
| T |
22867888 |
cca |
22867890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 13 - 121
Target Start/End: Original strand, 22801027 - 22801135
Alignment:
| Q |
13 |
gatgaatatgaatgaagacgaagtttaactagaaagtgatggtctcgagcaccatgcgagtgacctttcagcagcacgcaacaatggattgtcacaacca |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||| |
|
|
| T |
22801027 |
gatggatatgaatgaagacgaagtttaactagaaagtgatggtctcgagcaccatgcgagtgacctttcagcagcgaacaccaatggagtgtcacaacca |
22801126 |
T |
 |
| Q |
113 |
gaagaatac |
121 |
Q |
| |
|
||||||||| |
|
|
| T |
22801127 |
gaagaatac |
22801135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 22801210 - 22801255
Alignment:
| Q |
170 |
gtttccaatgtcgttaaccgtcctccagctgttcgatgaaatgcca |
215 |
Q |
| |
|
|||||||||| || ||||||||||||||||||| |||||||||||| |
|
|
| T |
22801210 |
gtttccaatgccgctaaccgtcctccagctgtttgatgaaatgcca |
22801255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University