View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15401_low_37 (Length: 332)
Name: NF15401_low_37
Description: NF15401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15401_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 15 - 315
Target Start/End: Original strand, 26452029 - 26452329
Alignment:
| Q |
15 |
ctgtgatgaaaatgcttgaattgggattctatcctgagtatttggatagagttgctgttatgcaaggtttaaggaaaaggatacagcaatatggaaattt |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26452029 |
ctgtaatgaaaatgcttgaattgggattctatcctgagtatttggatagagttgctgttatgcaaggtttaaggaaaaggatacagcaatatggaaattt |
26452128 |
T |
 |
| Q |
115 |
agatctttatatcaagctttgtaagtcactgtctgaagcaaatcttataggaccttgtcttgtgtatttgtatgttagaaaatataagctttgggttgtg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26452129 |
agatctttatatcaagctttgtaagtcactgtctgaagcaaatcttataggaccttgtcttgtgtatttgtatgttagaaaatataagctttgggttgtg |
26452228 |
T |
 |
| Q |
215 |
aaaatgatctaagaaaagttcttgtaaaaaacctgccaatttttcaaacctttggttttagaggcttagttgtgtattgtaactagagcatcgattttgt |
314 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26452229 |
aaaatgatctaagaaaagtacttgtaaaaaacctgccaatttttcaaacctttggttttagaggcttagttgtgtattgtaactagagcatcgattttgt |
26452328 |
T |
 |
| Q |
315 |
t |
315 |
Q |
| |
|
| |
|
|
| T |
26452329 |
t |
26452329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University