View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15401_low_57 (Length: 248)
Name: NF15401_low_57
Description: NF15401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15401_low_57 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 8 - 248
Target Start/End: Original strand, 48235396 - 48235636
Alignment:
| Q |
8 |
attattcttagtatcagtaaaaacttgattatcattacatccaaggcctcttaatctattaagctctggaagcacaactgatgcaagatttggcctatct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48235396 |
attattcttagtatcagtaaaaacttgattatcattaaatccaaggcctcttaatctattaagctctggaagcacaactgatgcaagatttggcctatct |
48235495 |
T |
 |
| Q |
108 |
ttcttgcagagttctgcacaattcaatgctaattttgcaaatgatagagcctcttcaactggccaatcagtcaccgcagaatcaagaatctccgaaaact |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48235496 |
ttcttgcagagttctgcacaattcaatgctaattttgcaaatgatagagcctcttcaactggccaatcagtcaccgcagaatcaagaatctctgaaaact |
48235595 |
T |
 |
| Q |
208 |
gctccttttcaattgcccttttaacatgatgagaaagtccc |
248 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48235596 |
ggtccttttcaattgcccttttaacatgatgagaaagtccc |
48235636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 213 - 248
Target Start/End: Complemental strand, 3686899 - 3686864
Alignment:
| Q |
213 |
ttttcaattgcccttttaacatgatgagaaagtccc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
3686899 |
ttttcaattgcccttttaacatgatgagaaagtccc |
3686864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 181
Target Start/End: Complemental strand, 42674307 - 42674255
Alignment:
| Q |
129 |
ttcaatgctaattttgcaaatgatagagcctcttcaactggccaatcagtcac |
181 |
Q |
| |
|
||||| |||||||| |||| ||||| ||||||||| || |||||||||||||| |
|
|
| T |
42674307 |
ttcaaagctaatttagcaagtgataaagcctcttcgaccggccaatcagtcac |
42674255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University