View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15401_low_63 (Length: 236)
Name: NF15401_low_63
Description: NF15401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15401_low_63 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 7 - 236
Target Start/End: Original strand, 48494231 - 48494461
Alignment:
| Q |
7 |
tagattatactgcttgatttttgcatgaccatgtttattaatccatcccaccattgcacttgaaccaaccatctttccatctctagaaaatccaatcccc |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48494231 |
tagataatactgcttgatttttgcatgaccatgtttattaatccatcccaccattgcacttgaaccaaccatctttccatctctagaaaatccaatcccc |
48494330 |
T |
|
| Q |
107 |
acccacccaactgtgaagggtgcagataatatgattgttgtggtatcaccattttttgtgtactgcaat-aaaacctcacgacattattagatgcaaagg |
205 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48494331 |
acccacccaactgtgtagggtgcagataatatgattgttgtggtatcaccattttttgtgtactgcaataaaaacctcacgacattattagatgcaaagg |
48494430 |
T |
|
| Q |
206 |
aacacctcatgacattcaaataataataaat |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
48494431 |
aacacctcatgacattcaaataataataaat |
48494461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University