View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15401_low_68 (Length: 224)
Name: NF15401_low_68
Description: NF15401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15401_low_68 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 13 - 206
Target Start/End: Original strand, 41035216 - 41035404
Alignment:
| Q |
13 |
gtgagaagaaaataagaaacagagagaaaattagatattaaatgaatgccgaaaagttagatgagcacaaatgtaagagctcaatcaaaaaattagtatt |
112 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41035216 |
gtgataagaaaataagaaactgagagaaaattagatat-----gaatgccgaaaagttagatgagcacaaatgtaagagctcaatcaaagaattagtatt |
41035310 |
T |
 |
| Q |
113 |
tgtggctccgtgcgatgcaacaaatttagatcaaggacacctgttttattgcaaagaatgaaagaagaaaagaaaatattgctcatgtgaaaca |
206 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
41035311 |
tatggctccgtgcgatgcaacaaatttagatcaacgacacctgttttattgcaaagaatgagagaagaaaagaaaatattgcttatgtgaaaca |
41035404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University