View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15401_low_70 (Length: 213)
Name: NF15401_low_70
Description: NF15401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15401_low_70 |
 |  |
|
| [»] scaffold0066 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 33992000 - 33992202
Alignment:
| Q |
1 |
taaacgtgaataaaaaattttgaagactaaactttaaaagtttataattttgtagggactaannnnnnnnnaatgtcaactctca--gagaattttgtca |
98 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||| |
|
|
| T |
33992000 |
taaacgtgaataaaaaattttggagactaaactttaaaagtttataattttgtagggactaatttttttttaatgtcaactctcatagagaattttatca |
33992099 |
T |
 |
| Q |
99 |
tttgcaattatgatctacttgactcaagtgattaatctcttgcacactgaagaatactcgattaaaatcaaaaattaatgtcaaatgtgtcatttgatct |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33992100 |
tttgcaattatgatctacttgactcaagtgattaatctcttgcacaccaaagaatactcgattaaaaacaaaaattaatgtcaaatgtgtcatttgatct |
33992199 |
T |
 |
| Q |
199 |
tga |
201 |
Q |
| |
|
||| |
|
|
| T |
33992200 |
tga |
33992202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 61
Target Start/End: Complemental strand, 14963 - 14935
Alignment:
| Q |
33 |
tttaaaagtttataattttgtagggacta |
61 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14963 |
tttaaaagtttataattttgtagggacta |
14935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University