View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15402_low_1 (Length: 247)
Name: NF15402_low_1
Description: NF15402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15402_low_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 3 - 229
Target Start/End: Original strand, 371046 - 371272
Alignment:
| Q |
3 |
gagaaacttcgagttcacccatgagtagttgagaaggtaagcatggaatcgtactccaagagttggtacctaaagtaagaaccctaacttcagtttcgca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
371046 |
gagaaacttcgagttcacccatgagtagttgagaaggtaagcatggaatcgtactccaagagttggtacctaaagtaagaaccctaacttcagtttcgca |
371145 |
T |
 |
| Q |
103 |
agaattatcgatttgtttgaacgaaatggcaactaccttataactatcggtgaaataatcatacccgatactgtatacaacatcaaatgaactataaggt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
371146 |
agaattatcgatttgtttgaacgaaatggcaactaccttataactatcggtgaaataatcatacccgatactgtatacaacatcaaatgaactataaggt |
371245 |
T |
 |
| Q |
203 |
agattttccaaaggttgcaatatcttg |
229 |
Q |
| |
|
||||||||||||||| ||||||||||| |
|
|
| T |
371246 |
agattttccaaaggtggcaatatcttg |
371272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University