View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15403_high_1 (Length: 627)
Name: NF15403_high_1
Description: NF15403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15403_high_1 |
 |  |
|
| [»] scaffold0633 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 2e-97; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 2e-97
Query Start/End: Original strand, 12 - 192
Target Start/End: Original strand, 32065975 - 32066155
Alignment:
| Q |
12 |
aaaggcgcaaagtacaagaatgtgaaagtgggaggagattggaagaggttgaagtgaagagcaaggtaggtgaagaggaagcaagcatggccattgttgc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32065975 |
aaaggcgcaaagtacaagaatgtgaaagtgggaggagattggaagaggttgaagtgaagagcaaggtaggtgaagaggaagcaagcatggccattgttgc |
32066074 |
T |
 |
| Q |
112 |
taaagagtatgagaaccagcagttccagataaagctaaccacttatttccttcctttctcatttccaacagtatgtatggt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32066075 |
taaagagtatgagaaccagcagttccagataaagctaaccacttatttccttcctttctcatttccaacagtatgtatggt |
32066155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 447 - 520
Target Start/End: Original strand, 32066441 - 32066514
Alignment:
| Q |
447 |
tgaattagaacacggtaatgatagatttaattacgaaagggtaaactatgatgtttagtgtttttctcatattt |
520 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32066441 |
tgaattagaacacggtaatgataggtttaattgcgaaagggtaaactatgatgtttagtgtttttctcatattt |
32066514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 56 - 112
Target Start/End: Complemental strand, 41668085 - 41668029
Alignment:
| Q |
56 |
gaggttgaagtgaagagcaaggtaggtgaagaggaagcaagcatggccattgttgct |
112 |
Q |
| |
|
||||||| || |||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41668085 |
gaggttgcagagaagagcagggtagatgaagaggaagcaagcatggccattgttgct |
41668029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0633 (Bit Score: 41; Significance: 0.00000000000006; HSPs: 1)
Name: scaffold0633
Description:
Target: scaffold0633; HSP #1
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 56 - 112
Target Start/End: Original strand, 7141 - 7197
Alignment:
| Q |
56 |
gaggttgaagtgaagagcaaggtaggtgaagaggaagcaagcatggccattgttgct |
112 |
Q |
| |
|
||||||| || |||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7141 |
gaggttgcagagaagagcagggtagatgaagaggaagcaagcatggccattgttgct |
7197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University