View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15407_high_10 (Length: 226)
Name: NF15407_high_10
Description: NF15407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15407_high_10 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 35232297 - 35232072
Alignment:
| Q |
1 |
aactcgatatatgattcatatcaatataatctgccccaaactatgaatgtgttgttgtcatcatgaatgaaaggcagcctactatgctatggccgaatgc |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35232297 |
aactctatatatgattcatatcaatataatctaccccaaactatgaatgtgttgttgtcatcatgaatgaaaggcagcctactatgctttggccgaatgc |
35232198 |
T |
|
| Q |
101 |
tacatctataatgtatgactttttcttgggttgttattggtaacaacattttttagctagatctgattttctgggataataagggtcactaaaagaaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
35232197 |
tacatctataatgtatgactttttcttgggttgttattgggaacaacattttttagctagatctggttttctgggataataaggatcactaaaagaaaag |
35232098 |
T |
|
| Q |
201 |
ttgttgggggatattggcgttggctt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
35232097 |
ttgttgggggatattggcgttggctt |
35232072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University