View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15407_low_11 (Length: 247)
Name: NF15407_low_11
Description: NF15407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15407_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 11 - 176
Target Start/End: Complemental strand, 22544246 - 22544081
Alignment:
| Q |
11 |
cagagaggttcaatgtaagttggaagtcaaaacccatactgaagccctatcaacaagttaaacaaggaatgtatttgtaacccatcttcaccaagtactt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22544246 |
cagagaggttcaatgtaagttggaagtcaaaacccatactgaagccctatcaacaagttaaacaaggaatgtatttgtaacccatcttcaccaagtactt |
22544147 |
T |
|
| Q |
111 |
gaaatcccagtgacaagagaaaataatcgaaaataacttagtagggccggtttggtttgaaaaaac |
176 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
22544146 |
gaaatcccagtgacatgagaaaataatcgaaaataacttagtaggcccggtttggtttaaaaaaac |
22544081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 213 - 247
Target Start/End: Complemental strand, 22544044 - 22544010
Alignment:
| Q |
213 |
acagaactaagagtttgtgtcctattttcaaaaat |
247 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
22544044 |
acagaactaacagtttgtgtcctattttcaaaaat |
22544010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University