View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15407_low_12 (Length: 237)
Name: NF15407_low_12
Description: NF15407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15407_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 3 - 183
Target Start/End: Complemental strand, 22543803 - 22543623
Alignment:
| Q |
3 |
aacatgcatctttgaaaatataggaaacaaatgtgttttgcaattaaaagtaaaacgcgtaaaatcattttctaaaaccaaacatttagcatgcaacgta |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||| ||||| | |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22543803 |
aacatgcatctttgaaaatataggaaacaaatgtgttatgcaatcaaaagcaaaacacataaaataattttctaaaaccaaacatttagcatgcaacgta |
22543704 |
T |
 |
| Q |
103 |
aaacataagcaactcatcaatgcaacaaaactatcatctcatcaaccaactctcaaaccattatttagattcaaataccaa |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22543703 |
aaacataagcaactcatcaatgcaacaaaaccatcatctcatcaaccaactctcaaaccattatttagattcaaataccaa |
22543623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University