View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15408_high_26 (Length: 309)
Name: NF15408_high_26
Description: NF15408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15408_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 297
Target Start/End: Original strand, 1797938 - 1798234
Alignment:
| Q |
1 |
tagatccggccgcatctccggtgtcggtggtgttggaagaagctgttttcgggtctcggcgccgacggtgctttgttgttttcgtaccacccttcttcta |
100 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
1797938 |
tagatctggccgcatctccggcgtcggtggtgttggaagaagctgttttcgggtctcggcgccgacggtgctgtgttgttttcgtaccacccttcttcca |
1798037 |
T |
 |
| Q |
101 |
gatatgccgcatttccggcaccggtggttgtggaaaaagttgtttttgggtccggcaccgacggtggtttgtgggtttcgtttgggtggtcgtgattctg |
200 |
Q |
| |
|
||| |||||||| |||| ||||||||||||||||| |||||||||||||||| | || ||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1798038 |
gatctgccgcatctccgacaccggtggttgtggaagaagttgtttttgggtctgacatcgatggtggtttgtgggtttcgtttgggtggtcgtgactctg |
1798137 |
T |
 |
| Q |
201 |
gtctttggtttgtgtaagaaccactgttgtgtttctgtgatgggtcgttgctcgttgatctgcaaatgctatttcaagctggtttgttttggatttt |
297 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||||||||||||||||||||||| |||| | |||||||||| |
|
|
| T |
1798138 |
gtctttggtttgtgtaagaaccattgttgtgtttccgtaatgggtcgttgctcgttgatctgcaaatgctatttcaagcgggttggctttggatttt |
1798234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University