View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15408_low_11 (Length: 434)
Name: NF15408_low_11
Description: NF15408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15408_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 17 - 401
Target Start/End: Complemental strand, 31763323 - 31762947
Alignment:
| Q |
17 |
gcaacctgggaaaccgtgtttttgaattaggttttaacacgataatatttaactccatagtagagcataaaagcaaaccaaagtaatcggaaaaagaaga |
116 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31763323 |
gcaacctgggaaatcgtgtttttgaattaggttttaacacgataatatttaactccatagtagagcataaaagcaaaccaaagtaatcggaaaaagaaga |
31763224 |
T |
|
| Q |
117 |
aagcgaaacctggaatttctcactgtttctggctgccggaaactaactccggatgcgttttccgacgagcnnnnnnnnnnnnnnnnnnnccggcgaaatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
31763223 |
aagcgaaacctggaatttctcactgtttctggctgccggaaactaactccggctgcgttttccgacgagc--ttttttttttttttttcccggcgaaatg |
31763126 |
T |
|
| Q |
217 |
agttcagtgcattcaaacttgtttctgctgtaagaagcggtagcggtagcggnnnnnnnnnnnnnngaaaaaatagattgggctttttatctcaaatttt |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31763125 |
agttcagtgcattcaaacttgtttctgctgtaagaagcggtagcggt------tttttttatttttgaaaaaatagattgggctttttatctcaaatttt |
31763032 |
T |
|
| Q |
317 |
aatgatagtagaattcggagattttcttatcgcaccctccatccctctcacgcaccctccaaaattattattttatccgttcaaa |
401 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31763031 |
aatgatagtagaattcggagattttcttattccaccctccatccctctcacgcaccctccaaaattattattttatccgttcaaa |
31762947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 215 - 250
Target Start/End: Original strand, 32696520 - 32696555
Alignment:
| Q |
215 |
tgagttcagtgcattcaaacttgtttctgctgtaag |
250 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32696520 |
tgagttcagtgcattcaaacatgtttctgctgtaag |
32696555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University