View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15408_low_19 (Length: 358)
Name: NF15408_low_19
Description: NF15408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15408_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 20 - 233
Target Start/End: Complemental strand, 26170328 - 26170117
Alignment:
| Q |
20 |
gaaagattgaatcactctaattatgaagtctctctacctaacatgtttagagtgtgttttccaactccattttctcacgtaaaagctccactcctagctc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26170328 |
gaaagattgaatcactctaattatgaagtctctgtacctaacatgtttagagtgtgttttccaactccattttctcacgtaaaagctccactcctagctc |
26170229 |
T |
|
| Q |
120 |
ttaagtttccttaaatatatgctcttttggtaatgccgnnnnnnnnnnnnnnattcaagaactccacaagaagcattcaacacaagaatcatgatcttct |
219 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26170228 |
ttaaatttctttaaatatatgctcttttggtaatgccg--tctctctctctcattcaagaactccacaagaagcattcaacacaagaatcatgatcttct |
26170131 |
T |
|
| Q |
220 |
ctttgtgttcccta |
233 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
26170130 |
ctttgtgttcccta |
26170117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 229 - 341
Target Start/End: Complemental strand, 26170095 - 26169983
Alignment:
| Q |
229 |
ccctagtcacacacccaaaaggcactacacttcacctttaaactttctaagtaacccctcttttggtactttcaaacaatgaggtaaaaaactctactta |
328 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26170095 |
ccctagtcacacacccaaaaggcaccacacttcacctttaaactttctaagtaacccctcttttggtactttcaaacaatgaggtaaaaaactctactta |
26169996 |
T |
|
| Q |
329 |
taattcatttttt |
341 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
26169995 |
taagtcatttttt |
26169983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University