View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15408_low_33 (Length: 272)
Name: NF15408_low_33
Description: NF15408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15408_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 12 - 192
Target Start/End: Original strand, 39708930 - 39709110
Alignment:
| Q |
12 |
atgaaacccaactaagagatattactcatttttcacacattatgttagaaaaattacacatgtgtcacttatgacttcttcaacataataaatatatttt |
111 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39708930 |
atgaaacccaactaagagatattactcctttttcacacattatgttagaaaaattacacatgtgtcacttatgacttcttcaacataataaatatatgtt |
39709029 |
T |
 |
| Q |
112 |
caatcatcgtaagcttaactcagttgttgttaaggacaatatataacataatgtagaagtcagagttcgaaccccgacact |
192 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
39709030 |
caatcttcgtaagcttaactcagttgttgttagagacaatatataacataatttaaaagtcagagttcgaaccccgacact |
39709110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 256
Target Start/End: Original strand, 39709178 - 39709213
Alignment:
| Q |
221 |
ttcctctgtcattttcactaaaatatataaaattat |
256 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39709178 |
ttcctctgtcattttcagtaaaatatataaaattat |
39709213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University