View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15408_low_44 (Length: 237)
Name: NF15408_low_44
Description: NF15408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15408_low_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 10 - 222
Target Start/End: Original strand, 4090077 - 4090289
Alignment:
| Q |
10 |
gcataggaagttcagggtcaactgtgtaaacatgataacttgaatcacttaaacatggaacttcaatgaattttgtttgtgaaagtcttgtggagcaatt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4090077 |
gcataggaagttcagggtcaactgtgtaaacatgataacttgaatcacttaaacatggaacttcaatgaattttgtttgtgaaagtcttgtggagcaatt |
4090176 |
T |
 |
| Q |
110 |
gaggtatgtgaagtttttaagaacgtagtagtattggaacggtgtgagggtgaggttaaggttgagaaagactctgtggacacagtttttgggatcaaga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4090177 |
gaggtatgtgaagtttttaagaacgtagtagtattggaacggtgtgagggtgaggttaaggttgagaaagactctgtggacacagtttttgggatcaaga |
4090276 |
T |
 |
| Q |
210 |
agatcaatctttt |
222 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4090277 |
agatcaatctttt |
4090289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University