View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15408_low_45 (Length: 236)
Name: NF15408_low_45
Description: NF15408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15408_low_45 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 2836462 - 2836254
Alignment:
| Q |
1 |
tctacatggtttgtacacattagaactagccttgtttaataccataaaaaatctttacaggaaaagtttttactaattaattctagagattgtaatcatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2836462 |
tctacatggtttgtacacattagaactagccttgtttaataccataaaaaatctttacaggaaaagtttgtactaattaattctagagattgtaatcatt |
2836363 |
T |
|
| Q |
101 |
catacaagtaaaagtgtagggaacaaatgtttaaaattgttcaatcgcaaaggtcatatatgagaaactaattgaaccagttttaaacatttcagtttct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2836362 |
catacaagtaaaagtgtagggaacaaatgtttaaaattgttcaatcgcaaaggtc-----------actaattgaaccagttttaaacatttcagtttct |
2836274 |
T |
|
| Q |
201 |
cttctctgacctgtatgatc |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
2836273 |
cttctctgacctgtatgatc |
2836254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University