View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15408_low_46 (Length: 236)
Name: NF15408_low_46
Description: NF15408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15408_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 5 - 204
Target Start/End: Complemental strand, 30476218 - 30476020
Alignment:
| Q |
5 |
cttattagcctaattcatcttacaaaagcatgtagaatgggagaagacaaatatagttttagtccttcgagaaacagaaggaagagtgatctctgtctcc |
104 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30476218 |
cttattcgccaaattcatcttacaaaagcatgtagaatgggagaagacacatatagttttagtccttcgagaaacagaaggaagagtgatctctgtctcc |
30476119 |
T |
 |
| Q |
105 |
ttatttatttgttaaaagactaacacattttagctgactaggtgggtagaaacaacaatgtttgagtctttagggggagaattactctctctaagtaagt |
204 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30476118 |
ttatttatttgtt-aaagactaacacattttagctgactaggtgggtagaaacaacaatgtttgagtcttttgggggagaattactctctctaagtaagt |
30476020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University