View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15408_low_49 (Length: 202)
Name: NF15408_low_49
Description: NF15408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15408_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 81 - 187
Target Start/End: Complemental strand, 8403703 - 8403597
Alignment:
| Q |
81 |
accttcttcaaggaaaatggagagtccaaaatcagtagctttaacagcagcattctcatcttttgaagcaagcaagaaattctcaggcttaagatcacga |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8403703 |
accttcttcaaggaaaatggagagtccaaaatcagtagctttaacagcagcattctcatcttttgaagcaagcaagaaattctcaggcttaagatcacga |
8403604 |
T |
|
| Q |
181 |
tgcataa |
187 |
Q |
| |
|
||||||| |
|
|
| T |
8403603 |
tgcataa |
8403597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 173
Target Start/End: Complemental strand, 8405088 - 8405020
Alignment:
| Q |
105 |
tccaaaatcagtagctttaacagcagcattctcatcttttgaagcaagcaagaaattctcaggcttaag |
173 |
Q |
| |
|
|||||||||||| ||||| | || ||| || | |||||| ||||||||||||||||||||||||||| |
|
|
| T |
8405088 |
tccaaaatcagtggctttcaaaggagccttatgatctttactagcaagcaagaaattctcaggcttaag |
8405020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University