View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15408_low_6 (Length: 534)
Name: NF15408_low_6
Description: NF15408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15408_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 52; Significance: 1e-20; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 138 - 205
Target Start/End: Original strand, 9715964 - 9716031
Alignment:
| Q |
138 |
tagtattattatactacaggatattaaaatttcctccaaacaaagggggttaggaatgcagaaaacat |
205 |
Q |
| |
|
|||||||||||||||||| ||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9715964 |
tagtattattatactacatgatgttaatttttcctccaaacaaagggggttaggaatgcagaaaacat |
9716031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 91 - 119
Target Start/End: Original strand, 9715882 - 9715910
Alignment:
| Q |
91 |
gtttcttttttcatttaggttaaaaagac |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9715882 |
gtttcttttttcatttaggttaaaaagac |
9715910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 298
Target Start/End: Complemental strand, 12918891 - 12918830
Alignment:
| Q |
237 |
aataaaggttaaaatttgtttttgattccggtaaatttgacgagtttgagttttagtctctg |
298 |
Q |
| |
|
||||||||||||||| ||||||| | | | |||| ||||||||||||||||||||||||| |
|
|
| T |
12918891 |
aataaaggttaaaatgtgtttttcgtcgctgcaaatatgacgagtttgagttttagtctctg |
12918830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University