View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15408_low_6 (Length: 534)

Name: NF15408_low_6
Description: NF15408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15408_low_6
NF15408_low_6
[»] chr5 (2 HSPs)
chr5 (138-205)||(9715964-9716031)
chr5 (91-119)||(9715882-9715910)
[»] chr2 (1 HSPs)
chr2 (237-298)||(12918830-12918891)


Alignment Details
Target: chr5 (Bit Score: 52; Significance: 1e-20; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 138 - 205
Target Start/End: Original strand, 9715964 - 9716031
Alignment:
138 tagtattattatactacaggatattaaaatttcctccaaacaaagggggttaggaatgcagaaaacat 205  Q
    |||||||||||||||||| ||| ||||  |||||||||||||||||||||||||||||||||||||||    
9715964 tagtattattatactacatgatgttaatttttcctccaaacaaagggggttaggaatgcagaaaacat 9716031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 91 - 119
Target Start/End: Original strand, 9715882 - 9715910
Alignment:
91 gtttcttttttcatttaggttaaaaagac 119  Q
    |||||||||||||||||||||||||||||    
9715882 gtttcttttttcatttaggttaaaaagac 9715910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 298
Target Start/End: Complemental strand, 12918891 - 12918830
Alignment:
237 aataaaggttaaaatttgtttttgattccggtaaatttgacgagtttgagttttagtctctg 298  Q
    ||||||||||||||| |||||||  |  | | |||| |||||||||||||||||||||||||    
12918891 aataaaggttaaaatgtgtttttcgtcgctgcaaatatgacgagtttgagttttagtctctg 12918830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University